Open Access

Different responses to mechanical injury in neonatal and adult ovine articular cartilage

BioMedical Engineering OnLine201312:53

https://doi.org/10.1186/1475-925X-12-53

Received: 11 March 2013

Accepted: 10 June 2013

Published: 17 June 2013

Abstract

Background

Articular cartilage injury remains a major challenge in orthopedic surgery. This study aimed to identify differences in gene expression and molecular responses between neonatal and adult articular cartilage during the healing of an injury.

Methods

An established in vitro model was used to compare the transcriptional response to cartilage injury in neonatal and adult sheep by microarray analysis of gene expression. Total RNA was isolated from tissue samples, linearly amplified, and 15,208 ovine probes were applied to cDNA microarray. Validation for selected genes was obtained by real-time quantitative polymerase chain reaction (RT-qPCR).

Results

We found 1,075 (11.6%) differentially expressed probe sets in adult injured cartilage relative to normal cartilage. A total of 1,016 (11.0%) probe sets were differentially expressed in neonatal injured cartilage relative to normal cartilage. A total of 1,492 (16.1%) probe sets were differentially expressed in adult normal cartilage relative to neonatal normal cartilage. A total of 1,411 (15.3%) probe sets were differentially expressed in adult injured cartilage relative to neonatal injured cartilage. Significant functional clusters included genes associated with wound healing, articular protection, inflammation, and energy metabolism. Selected genes (PPARG, LDH, TOM, HIF1A, SMAD7, and NF-κB) were also found and validated by RT-qPCR.

Conclusions

There are significant differences in gene expression between neonatal and adult ovine articular cartilage following acute injury. They are partly due to intrinsic differences in the process of development, and partly to different biological responses to mechanical trauma between neonatal and adult articular cartilage.

Keywords

Cartilage Microarray Mechanical injury Neonatal Ovine Differential gene expression

Background

Articular cartilage injury remains a major challenge in orthopedic surgery. This may be mainly due to the specific morphological structure of articular cartilage [1]. Articular cartilage is a highly ordered, specialized connective tissue, which provides a smooth surface and low friction weight-bearing support used for protection of joints by absorbing mechanical stresses and loads [2]. Traumatic cartilage injury leads to an irreversible cartilage loss because differentiated chondrocytes do not divide, and therefore, do not compensate for these defects. Previous studies have reported that post-traumatic articular cartilage in adults is often fibrous cartilage or hyaline-like cartilage of which the biological properties and mechanical strength are inferior to normal cartilage [3]. However, the results from a clinical study indicated that acute full-thickness joint surface defects show the potential for intrinsic repair in young individuals [4]. Similarly, spontaneous repair of relatively small, experimental, full-thickness joint surface defects in animal models has been reported [5]. Spontaneous repair can be complete in a fetal lamb articular cartilage superficial defects model [6].

The different mechanisms of cartilage repair in young and adult articular cartilage are unclear. Changes at the molecular level, consisting of key genes or signaling pathways, may occur during the developmental process, and this might lessen the repair ability of articular cartilage.

This study compared the transcriptional response to cartilage injury in neonatal and adult sheep. This study aimed to identify the portion of gene regulation associated (and perhaps responsible for) successful healing. Our findings could be important for designing instruments to induce cartilage repair.

Methods

Ex vivo cartilage injury model and tissue culture

Articular cartilage explants were harvested from adult (n = 3, 2 years old) and neonatal sheep (n = 3, 1 week old) bilateral femoral medial condyle. These animals were housed in the animal center of the Tongji Medical College, Huazhong University of Science and Technology. The study was approved by the Ethical Committee for Animal Experiments of Tongji Medical College, Huazhong University of Science and Technology.

The experimental design of cartilage injury was as follows: adult experiment (injury) versus adult control (normal); neonatal experiment (injury) versus neonatal control (normal); adult experiment (injury) versus neonatal experiment (injury); and adult control (normal) versus neonatal control (normal). Cartilage explants were washed in phosphate-buffered saline and maintained in a culture medium as previously described [7], containing Dulbecco’s modified Eagle’s medium /F12 (Invitrogen) in the presence of 10% fetal bovine serum (Invitrogen), and 100 units/ml penicillin and streptomycin (Invitrogen) in a six-well culture plate at 37°C in a humidified 5% CO2 atmosphere. The medium was changed every other day, and after 6 days, the medium was removed. Our model of cartilage injury is summarized in Figure 1A. Cartilage explants at left side were dissected onto a 2 × 2 mm2 grid (horizontal and vertical at 2-mm intervals) using a scalpel. Care was taken to avoid contamination by blood, bone, or synovium. The explant at right side was used for control samples. After 24 h, articular cartilage explants were shaved from the joint surfaces and preserved in liquid nitrogen for later RNA extraction.
Figure 1

The morphological assessment of injury/normal tissue and hierarchical clustering analysis of genes expression. A. The model of articular cartilage injury. Articular cartilage explants were dissected onto a 2 × 2 mm2 grid (horizontal and vertical at 2-mm intervals). B. Histomorphometric comparison of isotropic articular cartilage structure in the ovine neonate and anisotropic structure in adults. C. Histomorphometric comparison of injured neonatal and adult articular cartilage. D. The resulting gene trees were grouped (samples/conditions) together based on the similarity of their expression profiles. The dendrogram shows the relationships among the expression levels of conditions.

Histology

Samples were also collected and prepared for histological analyses as described by Frisbie et al. [8]. Briefly, normal articular cartilage tissue and injury were fixed in 10% neutral buffered formalin for a minimum of 2 days. Samples then had 0.1% EDTA/3% HCl decalcification solution added, which was replenished every 3 days until specimens were decalcified. Specimens were embedded in paraffin and sectioned at 5 μm. Sections were stained with hematoxylin and eosin.

Total RNA extraction

Total RNA was isolated as described by Dell’Accio et al. [7]. Briefly, each frozen explant was pulverized using a mortar and pestle pre-chilled in liquid nitrogen, suspended in 4 ml of TRIzol reagent (Invitrogen), and homogenized using a Mini-Bead-Beater-16 (Biospec). This was followed by differential alcohol and salt precipitations, and then final purification was performed using the Qiagen RNeasy Mini Kit by following the manufacturer’s protocol. RNA quantification and quality assurance were tested by NanoDrop-1000. Purity and integrity were assessed using the Agilent 2100 Bioanalyzer. The RNA quality was selected for microarray analysis of gene expression and quantitative real-time polymerase chain reaction (RT-qPCR).

Microarray analysis

Total RNA from each tissue sample was amplified and labeled using the Agilent Quick Amp labeling kit, and hybridized with the Agilent whole genome oligo microarray in Agilents SureHyb hybridization chambers [9]. After hybridization and washing, the processed slides were scanned with a DNA microarray scanner (Agilent, part number G2505B) using settings recommended by Agilent Technologies. Feature Extraction software (version 10.5.1.1) was used to assess fluorescent hybridization signals and to normalize signals using linear regression and a Lowess curve-fit technique. Reproducibility and reliability of each single microarray were assessed using quality control report data (Feature Extraction software, version 10.5.1.1).

Quantitative real-time RT-qPCR

Quantitative real-time RT-PCR was performed as described previously [7]. Gene expression was calculated using a standard curve and was normalized to the expression of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Purified RNA was reversely transcribed into cDNA using Superscript II RT (Invitrogen). Equivalent amounts as calculated by the initial RNA quantity were added to the reaction mix including 12.5 ml SYBR Green (Invitrogen), forward and reverse primers (10 pmol/ml), with 0.5 ml for each primer, and nuclease-free water to final volumes of 25 ml per well. Primer sequences are listed in Table 1. Real-time RT-PCR was run in an ABI Prism 7700 Sequence Detection System (SDS) using the ABI Prism 7700 SDS software version 1.2.3.
Table 1

Primer nucleotide sequences used in quantitative real-time RT-qPCR assays for genes described in the study

Gene name

Gene symbol

Primer sequences

Ampliconsize (bp)

glyceraldehyde-3-phosphate dehydrogenase

GAPDH

F:5' GTTCCACGGCACAGTCAAGG3'

117

 

R:5' TACTCAGCACCAGCATCACCC3'

 

mothers against DPP (Drosophila)human homologue 7

SMAD7

F:5' ACAACCGCAGCAGTTACCC3'

129

 

R:5' TGTACGCCTTCTCGTAGTCAA3'

 

peroxisome proliferator-activated receptor gamma

PPARG

F:5' GCGACATCGACCAACTGAAC3'

274

 

R:5' ACGGAGCGAAACTGACACC3'

 

thappin ovine molecule

TOM

F:5' CCAGGTGGTGGTGCTTCTC3'

127

 

R:5' ACCGTTGATTGGACCCTTT3'

 

nuclear factor-kappa B

NFκB

F:5' ACGAGGATGATGAGAATGGATG3'

135

 

R:5' GCAGGAACACGGTTACAGGAC3'

 

lactate dehydrogenase

LDHA

F:5' GGGACAGAATGGAATCTCAGAC3'

296

 

R:5' TTGCCATCCAGCAGGGT3'

 

Hypoxia-inducible factor-1α

HIF1α

F;5'-CGAAGAACTCTCAGCCACAG-3'

174

  

R:5'-AGCTCGTGTCCT CAGATTCC-3'

 

Statistical analysis

The 12 microarray data sets were normalized in GeneSpring GX (version 11.0) using the Agilent FE (version 10.5.1.1) one-color scenario (quantile normalization). The entities were filtered based on their flag values of P (present), M (marginal), and A (absent). Only entities having the present and marginal flags in at least one sample are displayed in the profile plot.

Only genes with values exceeding background intensity in at least three samples of either condition for each comparison were used for two-way analysis of variance (ANOVA) with the least significant difference (LSD) t-test, which were followed by Benjamini and Hochberg correction based on a false discovery rate of 2.2% for probe sets with a p-value <0.01 [10]. Volcano plots were used to filter for genes differentially expressed by ≥2-fold and with p < 0.05. Unsupervised hierarchical clustering analysis was performed on this subset of genes.

For quantitative real-time RT-PCR, the gene expression ratio between every two groups was determined and analyzed using SPSS version 17.0 (SPSS Inc., Chicago, IL, USA).. The relative expression levels in every two compares for the selected genes were normalized to the endogenous reference gene GAPDH by using the formula 2-Ct target/2-Ct GAPDH, where Ct is the threshold cycle. All data are expressed as mean ± standard deviation. Differences were considered significant at p < 0.05.

Results

Articular cartilage histology

Tissue samples were harvested 24 h after injury induction of full-thickness cartilage lesions. Gross histomorphometric examination showed the transition from isotropic to anisotropic architecture in neonatal and adult ovine articular cartilage (Figure 1B). Histologically, lesion tissue generally had a homogeneous matrix architecture with elongated, flattened cells that interfaced with surrounding articular cartilage. Each lesion was dimpled in appearance and not completely level with the articular surface (Figure 1C).

Overall level of differential gene expression and annotated genes

Of the 15,208 gene probes, 9,252 probe sets were present in the PMA. Further analyses were carried out on these probe sets. Based on a p-value of 0.05, 1,075 (11.6%) probe sets were differentially expressed in adult injured cartilage relative to normal cartilage, 1,016 (11.0%) probe sets were differentially expressed in neonatal injured cartilage relative to normal cartilage, 1,492 (16.1%) probe sets were differentially expressed in adult normal cartilage relative to neonatal normal cartilage, and 1,411 (15.3%) probe sets were differentially expressed in adult injured cartilage relative to neonatal injured cartilage in each pair of samples (Figure 2).
Figure 2

Flowchart of cDNA microarray data analysis. The groups are as follows: adult injury (AI), adult control (AC), neonatal injury (NI), and neonatal control (NC). Expression data were initially analyzed by PMA and two-way ANOVA with the LSD t-test, with Benjamini and Hochberg correction. A total of 11.6, 10.9, 16.0, and 15.2% of the probe sets on the microarray showed significant differential gene expression in each pair (p < 0.05).

After Benjamini and Hochberg correction to compare gene expression in the four groups, 1,070, 1,005, 1,082, and 1,401 probes were identified as being significantly (p < 0.05) altered in each group. The estimated false discovery rate was 0.47, 1.1, 0.8, and 0.7%, respectively (Figure 2). A volcano plot shows that 86 and 83 genes were significantly regulated at least 2-fold post-injury for neonatal sheep (Figure 3B) and adult sheep, respectively (Figure 3A). A total of 132 probe sets were up-regulated (Figure 3D) in neonatal injured articular cartilage relative to adult articular cartilage. A total of 185 probe sets were up-regulated in adult injured articular cartilage relative to neonatal articular cartilage (Figure 3D). Comparative transcription profiling and gene annotation in each pair are listed in Table 2.
Figure 3

Volcano plots of adult experiment versus control (A), neonatal experiment versus control (B), adult versus neonatal control (C), and adult versus neonatal experiment (D). The vertical lines correspond to 2.0-fold up regulation and down regulation and the horizontal line represents a p-value of 0.05. Therefore, the red point in the plot represents the differentially expressed genes with statistical significance. The degree of statistical significance is displayed along the vertical axis and fold change expression is displayed along the horizontal axis.

Table 2

Comparative transcription profiling between the every two groups

Group

AI/AC

NI/NC

AC/NC

AI/NI

up-regulation

32

190

185

44

Annotated genes

CENP-C,LDHA,TNC,

ESR1, NF-κB, OVAR,

FZD3, NFkB1A, NOD2

SMAD7, TF, PPARG,

 

DCN,TNFα,IL-1β

PRKAR1A,PBR, EF-1,

MMP7, CAT-1, RAC-1

ERBA BETA, GRO,

  

MIF, HIF1A, SPRY-4,

CP, C-MET, CENP-C

IL-1β, TNF, IGFBP2,

  

ALDOA,CD40,PSMB8,

CAST, F11R, FAS

FCER1G

  

ERBA BETA,COL1A1,

  
  

BBC-1,FGF10, FBLN,

  
  

FAS, CPE, NOS2, CAST

  

down-regulation

50

150

132

42

Annotated genes

SIN1,COL2A1,FN

COL2A1, TXN, TNCC2,

VDUP1, BACT2, TOM

COL1A1,PPP1R12A,

 

HECTD1

OXT,TNC, TOM, HBB,

LDHA, PSMB7, G6PD,

SMCT1, IGF2, CD1D

  

PTGS1, IRF2, PSMB7,

SMAD7, CD1D, SIN1,

SFN

  

G6PD, CAT-1,CHID

HOXA7, HIF-1A

 

Notes:Adult Injury(AI), Adult Control(AC), Neonate Injury(NI), Neonate Control(NC). Fold Change ≥ 2.0; P < 0.05.

Among the 825 differentially expressed genes in total, 62 corresponded to known genes with a unique identifier, and sourced from RefSeq and UniGene. The expression of annotated genes in each pair is shown in Table 3.
Table 3

Different expression of annotated genes between the every two groups

Gene symbol

AI/AC

NI/NC

AC/NC

AI/NI

Gen bank accession

UniGene

SMAD7

2.36*(0.025)

2.04#(0.040)

EE805013

Oar.1034

FCER1G

3.16*(0.037)

AJ318335

Oar.1043

CD1D

3.14#(0.018)

3.04#(0.047)

NM_001123001

Oar.1049

G6PD

2.75#(0.016)

3.70#(0.042)

NM_001093780

Oar.1073

EF-1

2.82*(0.036)

NM_001009449

Oar.1074

SIN1

3.25#(0.023)

2.24#(0.008)

NM_001009768

Oar.1093

VDUP1

2.46#(0.007)

EE783894

Oar.12992

OVAR

3.06*(0.019)

NM_001130934

Oar.13205

MMP7

2.60*(0.048)

NM_001136491

Oar.13267

COL1A1

2.87#(0.042)

5.90#(0.036)

DY492568

Oar.13279

LDHA

2.18*(0.030)

2.81*(0.030)

2.12#(0.026)

EE751721

Oar.13281

PRKAR1A

2.57*(0.039)

NM_001142517

Oar.13311

CAV1

4.25*(0.013)

DY493176

Oar.13316

F11R

3.56*(0.026)

DY502182

Oar.13343

HBB

5.21#(0.021)

DY522642

Oar.13537

SMCT1

3.18#(0.011)

EU048233

Oar.14460

PPP1R12A

2.42#(0.022)

EU370548

Oar.14621

IGFBP-2

——

12.98*(0.038)

NM_001009436

Oar.15563

HECTD1

2.79#(0.005)

EU370535

Oar.16241

PSMB7

2.46#(0.027)

4.04#(0.013)

EU366497

Oar.16276

COL2A1

5.10#(0.019)

3.74#(0.006)

ACJ06529.1

Oar.17681

IGF2

3.64#(0.042)

NM_001009311

Oar.376

IL-1β

5.57*(0.002)

5.55*(0.009)

DY502470

Oar.434

OXT

9.76#(0.050)

NM_001009801

Oar.444

PTGS1

3.67#(0.030)

NM_001009476

Oar.445

TNFα

4.03*(0.018)

3.52*(0.004)

DY503545

Oar.455

RAC1

2.09*(0.003)

EE785210

Oar.4580

NOD2

6.75*(0.046)

AM932877

Oar.4731

FZD3

4.05*(0.023)

DQ152955

Oar.4758

NFKBIA

3.08*(0.011)

4.15*(0.039)

EE815518

Oar.4761

MIF

2.16*(0.050)

NM_001078655

Oar.4767

SPRY-4

2.44*(0.040)

DQ152992

Oar.4778

TOM

14.37#(0.020)

14.13#(0.015)

NM_001035224

Oar.4810

TXN

2.89#(0.015)

1.94#(0.033)

NM_001009421

Oar.482

FN

3.38#(0.048)

4.65*(0.008)

FJ234417.1

Oar.4888

HOXA7

2.36#(0.009)

U61979

Oar.496

CAST

2.61*(0.032)

2.35*(0.015)

NM_001009788

Oar.498

ERBA BETA1

3.52*(0.004)

3.34*(0.010)

Z68307

Oar.500

ESR1

68.55*(0.000)

AY033393

Oar.505

TNC

4.82*(0.008)

4.56#(0.004)

DY475966

Oar.5104

TNCC2

3.30#(0.029)

NM_001112821

Oar.5156

TF

8.97*(0.023)

EE771342

Oar.552

CPE

3.66*(0.025)

AF063109

Oar.622

NOS2

2.28*(0.037)

AF223942

Oar.645

BCAT2

2.10#(0.025)

AF050173

Oar.655

HIF1A

2.31*(0.039)

2.35#(0.030)

EE755982

Oar.6671

FAS

3.58*(0.046)

7.19*(0.046)

NM_001123003

Oar.683

CP

7.91*(0.049)

NM_001009733

Oar.706

DCN

3.06*(0.044)

NM_001009218

Oar.718

ALDOA

2.27*(0.047)

EE814113

Oar.733

BBC1

2.03*(0.008)

EE773437

Oar.76

FGF10

5.15*(0.032)

NM_001009230

Oar.7650

PBR

5.35*(0.017)

NM_001009747

Oar.779

C-MET

6.06*(0.037)

NM_001111071

Oar.794

CAT-1

3.31#(0.026)

2.20*(0.041)

AF212146

Oar.798

SFN

2.45#(0.041)

NM_001009208

Oar.814

PSMB8

5.58*(0.036)

NM_001131030

Oar.8196

CENP-C

3.38*(0.048)

2.12*(0.028)

U35657

Oar.847

GRO

3.46*(0.042)

NM_001009358

Oar.963

IRF2

2.30#(0.027)

NM_001009740

Oar.966

CD40

8.45*(0.047)

EE821767

Oar.989

PPARG

3.72*(0.002)

NM_001100921

Oar.992

Notes:Adult Injury(AI), Adult Control(AC), Neonate Injury(NI), Neonate Control(NC).

*:up-regulation; #:down-regulation; ( ):P-value; —: no statistical significance (P > 0.05).

Hierarchical clustering analysis

To investigate how gene expression varied across the samples, we performed hierarchical clustering analysis. In this analysis, samples were grouped according to their expression profile based on all genes, whether or not the genes were differentially expressed in the experimental (injured) versus the control (normal) group. A dendrogram shows the relationships among the expression levels of conditions. Our experiment consisted of 12 different conditions. The results of hierarchical clustering based on conditions showed a distinguishable gene expression profiling among samples (Figure 1D). Significant functional clusters included genes associated with wound healing, articular protection, repair integration, and energy metabolism. Such transcripts, including peroxisome proliferator activated receptor γ (PPARγ), trappin ovine molecule (TOM), mothers against DPP (Drosophila) human homolog 7 (SMAD7), nuclear factor-kappa B (NF-κB), hypoxia inducible factor-1α (HIF1-α), and lactate dehydrogenase (LDH) were regulated in their respective direction (up- or down-regulated) according to their change with tissue maturity/age and injury (Figure 3).

Results by quantitative real-time RT-PCR

Quantitative real-time RT-PCR was performed on the six up-regulated genes to validate the microarray results, including PPARγ, LDH, TOM, HIF1A, SMAD7, and NF-κB, which were associated with wound healing, articular protect, inflammation and energy metabolism according to literature [1113]. We found a significant increase in mRNA abundance for PPARγ and TOM in neonatal injured articular cartilage (Figure 4). Fold change differences were similar or slightly greater than those measured by microarray profiles. In general, the quantitative real-time RT-PCR and microarray data agreed well for most samples, emphasizing the robustness of the microarray data.
Figure 4

Quantitative real-time PCR measurement of differential gene expression. Adult injury (AI), adult control (AC), neonatal injury (NI), and neonatal control (NC). Quantification of transcript abundance indicates significant up-regulation of PPARγ (A), HIF1-A (B), LDH (C), TOM (D), SMAD7 (E), and NFκB (F) gene expression in neonatal injured articular cartilage compared with adult articular cartilage. The RT-qPCR data for all six target genes confirmed the results of microarray hybridization experiments. Mathematical means of expression are indicated below each age group, and mean fold differences for each target gene are also given numerically as ‘Mean FC’ under the abscissa. Two-sided t tests and an ANOVA were used for statistical analyses. *P values < 0.05 were considered statistically significant.

Discussion

Traumatic cartilage lesions represent a common symptomatic and disabling problem, which often requires surgical intervention to relieve pain and to prevent possible evolution towards secondary osteoarthritis [14]. In the present study, an ovine age-dependent ex-vivo articular cartilage model following acute injury was developed and characterized. Three pairs of adult and neonatal sheep articular cartilage were detected by cDNA microarray and validated by real time RT-PCR.

The repair of joint surface lesions largely depends on their size and depth [15, 16], and the reproducibility of the injury is an important concern. With regard to the choice of the time course of post-injury, Lee et al. showed that the expression of specific catabolic and anabolic genes that regulate matrix remodeling and turnover after mechanical injury within 24 h is the most significant [17].

Differential gene expression in equine articular cartilage maturation was studied by Mienaltowski et al. [18]. However, the use of microarrays has not been reported in different developmental stages of ovine articular cartilage. In the present study, the up-regulation of collagen type II (COL2A1) and tenascin-C (TNC) was observed in neonatal articular cartilage, while transcripts encoding matrix proteins and growth factors were more abundant in adults, including collagen type I (COL1A1), decorin, and fibroblast growth factor 10. The current data are consistent with previous findings in horses and humans [18, 19].

In adult injured articular cartilage versus normal articular cartilage, five annotated genes were significantly up-regulated. In contrast, the expression of four genes was slightly down-regulated. In particular, centromere protein-C, insulin growth factor binding protein 2, and LDH have not been previously linked to an imbalance of damage and repair in osteoarthritis, whereas, TNC and COL2A1 have already been reported [18].

Neonatal ovine lesional cartilage and normal articular cartilage were compared in this study. As expected, with the pattern of activation of inflammation and apoptosis-related genes broadly comparable to those reported in the adult [1], neonatal injured articular explants also had high levels of gene expression, such as interleukin 1β (IL-1β), tumor necrosis factor-α, growth-regulated oncogene α (GROα), and NF-κB.

In our study, transcripts encoding cartilage macromolecules and nuclear receptors, which play a role in cell-cell and cell-matrix interactions, tissue remodeling, and repair, were significantly more abundant in neonatal lesional articular cartilage compared with normal articular cartilage. There are two possible reasons for this finding. First, neonatal cartilage has different gene expression compared with adult cartilage, such as TOM, which may help its self-repair. Second, mechanical injury results in different responses between neonatal and adult cartilage. Our microarray analysis showed that transcripts, including PPARγ, HIF1-α, and SMAD7, are highly expressed in neonatal injured articular cartilage compared with the adult injury model.

PPARγ is expressed in chondrocytes and synoviocytes, and is present and functionally active in human chondrocytes [11]. Consistent with this finding, our study showed PPARγ was up-regulated 3.72-fold in injured neonatal articular cartilage compared with normal articular cartilage, whereas there was no significant difference in expression in the adult sheep injury model. Interestingly, there was also no difference in PPARγ expression in normal adult cartilage compared with neonatal cartilage. These findings suggested that neonatal cartilage showed a strong and unique response to mechanical injury. PPARγ has a significant protective effect and promotes cartilage repair in traumatized chondrocytes by several probable mechanisms. (1) Down-regulation of genes that encode catabolic factors could be involved in this process [20]. PPARγ agonists suppress the expression of inducible nitric oxide synthase and matrix metalloproteinase (MMP)-13 in human chondrocytes, as well as the expression of MMP-1 in human synovial fibroblasts. The inhibition of inducible nitric oxide synthase and MMP-13 induction is PPARγ dependent and occurs at the transcriptional level, probably through repression of NF-κB and AP-1 signaling [20]. The level of phosphorylation of JNK and p38 has also been shown to be diminished in response to specific stimuli in PPARγ-deficient mice [21]. (2) Anti-inflammatory effects are considered to mainly exert action through transrepressing proinflammatory genes in a DNA-binding-dependent manner [22, 23]. Trauma can induce inflammatory responses, and also activate the expression of anti-inflammatory factors synchronously. PPARγ may be a potential therapeutic agent for treating articular cartilage injury and defects. Therefore, further study is required on how to enhance PPARγ expression to promote cartilage repair in adult injured articular cartilage.

To date, TOM is found in several tissues, including epithelia, lungs, and macrophages [12]. To the best of our knowledge, no report describing a protease inhibitor as a cartilage-sparing agent has been published. However, we detected TOM gene expression in ovine articular cartilage. TOM expression was significantly increased in neonatal ovine articular cartilage after acute mechanical injury, with a 14.1-fold increase compared with control adult tissue. However, there was no significant difference in TOM expression in the adult sheep injury model. Interestingly, TOM gene expression was increased 15.73-fold in normal neonatal articular cartilage compared with adult articular cartilage. TOM gene expression has inherently high levels in neonatal ovine articular cartilage, which is beneficial to cartilage repair. In vitro studies have shown that the immobilization of trappin-2/elafin extracellular matrix proteins in articular cartilage plays a protective role by preserving structural integrity of the tissue against damage caused by neutrophilic infiltration during inflammation [24]. Trappin-2 and elafin may promote cartilage repair through their anti-inflammatory activities, which appear to be independent of their anti-elastase activity [25]. All of these processes may be involved in the reason for a stronger repair capacity in neonatal articular cartilage than adult cartilage.

Articular cartilage following acute injury results in the activation of a series of signaling responses. In the present study, SMAD7 mRNA in chondrocytes was up-regulated by 2.36-fold in neonatal injured articular cartilage compared with normal articular cartilage. In contrast, SMAD7 was down-regulated 2.04-fold in adult injured articular cartilage compared with the neonate. There was no difference in SMAD7 expression between normal adult and neonatal cartilage. SMAD7 is involved in cell signaling, which is a transforming growth factor β (TGFβ) type I receptor antagonist. Overexpression of SMAD7 totally prevents TGFβ-induced proteoglycan synthesis in chondrocytes at the mRNA and protein level and completely antagonizes the effects of TGFβ on proliferation [26]. Therefore, SMAD7 may cause cartilage degeneration and accelerate the response of the injury by inhibiting TGFβ signaling. SMAD7 acts in a negative feedback loop to inhibit TGFβ activity because of its interaction with ligand-activated TGFβRI, and it interferes with the phosphorylation of receptor-associated Smads, preventing nuclear translocation of the activated Smad complexes [27]. The effects of IL-1β on SMAD7 expression in human articular chondrocytes are mediated through the NF-κB pathway [13]. Interestingly, SMAD7 has been reported to regulate the NF-κB pathway. SMAD7 is able to block the TGFβ-induced phosphorylation of IκB, resulting in a decrease in NF-κB DNA binding [28]. Other studies have indicated that SMAD7 can also act as an NF-κB activator in some conditions [29]. In addition, a recent study showed that SMAD7 overexpression in transgenic mouse epidermis at levels comparable to those seen in pathological states is insufficient to block TGFβ or bone morphogenetic protein signaling, but instead produces striking phenotypes due to degradation of β-catenin through a novel mechanism involving Smad7 and Smurf2 [30].

SMAD7, NF-κB, and TGFβ pathways play a vital role in articular cartilage development and homeostasis. Therefore, a potential new mechanism for pathway cross-talk has important implications for the understanding of maturation and repair of articular cartilage.

Conclusions

There are significant differences in gene expression between neonatal and adult ovine articular cartilage following acute injury. These differences are partly due to intrinsic differences in the process of development and partly to different biological responses to mechanical trauma between neonatal and adult articular cartilage. Of these, PPARγ and TOM could be novel target molecules and potential chondroprotective agents involved in cartilage injury and complete repair.

Abbreviations

PPARγ: 

Peroxisome Proliferator Activated Receptor γ

TOM: 

Thappin Ovine Molecule

SMAD7: 

Mothers Against Dpp (Drosophila) Human Homolog 7

NF-κB: 

Nuclear Factor-Kappa B

HIF1-α: 

Hypoxia Inducible Factor 1α

LDH: 

Lactate Dehydrogenase

GAPDH: 

Glyceraldehyde-3-Phosphate Dehydrogenase

COL2A1: 

Collagen Type Ii

TNC: 

Tenascin-C

COL1A1: 

Collagen Type I

IL-1β: 

Interleukin 1β

GROα: 

Growth-Regulated Oncogene α

MSCs: 

Mesenchymal Stem Cells

MMP-13: 

Matrix Metalloproteinase-13

TGFβ: 

Transforming Growth Factor β.

Declarations

Acknowledgements

This work was supported by the National Natural Science Foundation of China (30872622). Technical assistance in Microarray experiments was provided us with by KangChen Bio-tech, Shanghai, China.

Authors’ Affiliations

(1)
Department of Orthopedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology

References

  1. Schulze-Tanzil G: Activation and dedifferentiation of chondrocytes: implications in cartilage injury and repair. Ann Anat 2009, 191(4):325–338. 10.1016/j.aanat.2009.05.003View ArticleGoogle Scholar
  2. Chan PS, Schlueter AE, Coussens PM, Rosa GJ, Haut RC, Orth MW: Gene expression profile of mechanically impacted bovine articular cartilage explants. J Orthop Res 2005, 23(5):1146–1151. 10.1016/j.orthres.2005.01.016View ArticleGoogle Scholar
  3. Mienaltowski MJ, Huang L, Frisbie DD, McIlwraith CW, Stromberg AJ, Bathke AC, et al.: Transcriptional profiling differences for articular cartilage and repair tissue in equine joint surface lesions. BMC Med Genomics 2009, 2: 60. 10.1186/1755-8794-2-60View ArticleGoogle Scholar
  4. Messner K, Maletius W: The long-term prognosis for severe damage to weight-bearing cartilage in the knee: a 14-year clinical and radiographic follow-up in 28 young athletes. Acta Orthop Scand 1996, 67(2):165–168. 10.3109/17453679608994664View ArticleGoogle Scholar
  5. Shapiro F, Koide S, Glimcher MJ: Cell origin and differentiation in the repair of full-thickness defects of articular cartilage. J Bone Joint Surg Am 1993, 75(4):532–553.Google Scholar
  6. Namba RS, Meuli M, Sullivan KM, Le AX, Adzick NS: Spontaneous repair of superficial defects in articular cartilage in a fetal lamb model. J Bone Joint Surg Am 1998, 80(1):4–10.Google Scholar
  7. Dell’Accio F, De Bari C, Eltawil NM: Identification of the molecular response of articular cartilage to injury, by microarray screening: Wnt-16 expression and signaling after injury and in osteoarthritis. Arthritis Rheum 2008, 58(5):1410–1421. 10.1002/art.23444View ArticleGoogle Scholar
  8. Frisbie DD, Bowman SM, Colhoun HA, DiCarlo EF, Kawcak CE, McIlwraith CW: Evaluation of autologous chondrocyte transplantation via a collagen membrane in equine articular defects: results at 12 and 18 months. Osteoarthr Cartil 2008, 16(6):667–679. 10.1016/j.joca.2007.09.013View ArticleGoogle Scholar
  9. Feldman AL, Costouros NG, Wang E, Qian M, Marincola FM, Alexander HR, et al.: Advantages of mRNA amplification for microarray analysis. Biotechniques 2002, 33(4):906–912. 914Google Scholar
  10. Benjamini Y, Hochberg Y: Controlling the false discovery rate: apractical and powerful approach to multiple testing. J Roy Stat Soc 1995, B: 289–300.MathSciNetGoogle Scholar
  11. Giaginis C, Giagini A, Theocharis S: Peroxisome proliferator-activated receptor-gamma (PPAR-gamma) ligands as potential therapeutic agents to treat arthritis. Pharmacol Res 2009, 60(3):160–169. 10.1016/j.phrs.2009.02.005View ArticleGoogle Scholar
  12. Guyot N, Zani ML, Maurel MC, Dallet-Choisy S, Moreau T: Elafin and its precursor trappin-2 still inhibit neutrophil serine proteinases when they are covalently bound to extracellular matrix proteins by tissue transglutaminase. Biochemistry 2005, 44(47):15610–15618. 10.1021/bi051418iView ArticleGoogle Scholar
  13. Baugé C, Attia J, Leclercq S, Pujol JP, Galéra P, Boumédiene K: Interleukin-1beta up-regulation of Smad7 via NF-kappaB activation in human chondrocytes. Arthritis Rheum 2008, 58(1):221–226. 10.1002/art.23154View ArticleGoogle Scholar
  14. Smith GD, Knutsen G, Richardson JB: A clinical review of cartilage repair techniques. J Bone Joint Surg Br 2005, 87(4):445–449.View ArticleGoogle Scholar
  15. Eltawil NM, De Bari C, Achan P, Pitzalis C, Dell’accio F: A novel in vivo murine model of cartilage regeneration. Age and strain-dependent outcome after joint surface injury. Osteoarthr Cartil 2009, 17(6):695–704. 10.1016/j.joca.2008.11.003View ArticleGoogle Scholar
  16. Wang Y, Ding C, Wluka AE, Davis S, Ebeling PR, Jones G, et al.: Factors affecting progression of knee cartilage defects in normal subjects over 2 years. Rheumatology (Oxford) 2006, 45(1):79–84. 10.1093/rheumatology/kei108View ArticleGoogle Scholar
  17. Lee JH, Fitzgerald JB, Dimicco MA, Grodzinsky AJ: Mechanical injury of cartilage explants causes specific time-dependent changes in chondrocyte gene expression. Arthritis Rheum 2005, 52(8):2386–2395. 10.1002/art.21215View ArticleGoogle Scholar
  18. Mienaltowski MJ, Huang L, Stromberg AJ, MacLeod JN: Differential gene expression associated with postnatal equine articular cartilage maturation. BMC Musculoskelet Disord 2008, 9: 149. 10.1186/1471-2474-9-149View ArticleGoogle Scholar
  19. Geyer M, Grässel S, Straub RH, Schett G, Dinser R, Grifka J, et al.: Differential transcriptome analysis of intraarticular lesional vs intact cartilage reveals new candidate genes in osteoarthritis pathophysiology. Osteoarthr Cartil 2009, 17(3):328–335. 10.1016/j.joca.2008.07.010View ArticleGoogle Scholar
  20. Fahmi H, Di Battista JA, Pelletier JP, Mineau F, Ranger P, Martel-Pelletier J: Peroxisome proliferator-activated receptor gamma activators inhibit interleukin-1beta-induced nitric oxide and matrix metalloproteinase 13 production in human chondrocytes. Arthritis Rheum 2001, 44(3):595–607. 10.1002/1529-0131(200103)44:3<595::AID-ANR108>3.0.CO;2-8View ArticleGoogle Scholar
  21. Kobayashi T, Notoya K, Naito T, Unno S, Nakamura A, Martel-Pelletier J, et al.: Pioglitazone, a peroxisome proliferator-activated receptor gamma agonist, reduces the progression of experimental osteoarthritis in guinea pigs. Arthritis Rheum 2005, 52(2):479–487. 10.1002/art.20792View ArticleGoogle Scholar
  22. Rizzo G, Fiorucci S: PPARs and other nuclear receptors in inflammation. Curr Opin Pharm 2006, 6: 421–427. 10.1016/j.coph.2006.03.012View ArticleGoogle Scholar
  23. Belvisi MG, Hele DJ, Birrell MA: Peroxisome proliferator-activated receptor gamma agonists as therapy for chronic airway inflammation. Eur J Pharmacol 2006, 533(1–3):101–109.View ArticleGoogle Scholar
  24. Zani ML, Nobar SM, Lacour SA, Lemoine S, Boudier C, Bieth JG, et al.: Kinetics of the inhibition of neutrophil proteinases by recombinant elafin and pre-elafin (trappin-2) expressed in Pichia pastoris. Eur J Biochem 2004, 271(12):2370–2378. 10.1111/j.1432-1033.2004.04156.xView ArticleGoogle Scholar
  25. Guyot N, Butler MW, McNally P, Weldon S, Greene CM, Levine RL, et al.: Elafin, an elastase-specific inhibitor, is cleaved by its cognate enzyme neutrophil elastase in sputum from individuals with cystic fibrosis. J Biol Chem 2008, 283(47):32377–32385. 10.1074/jbc.M803707200View ArticleGoogle Scholar
  26. Scharstulh A, Diepens R, Lensen J, Vitters E, van Beunigen H, Van der Kraan P, et al.: Adenoviral overexpression of Smad-7 and Smad-6 differentially regulates TGF-beta-mediated chondrocyte proliferation and proteoglycan synthesis. Osteoarthr Cartil 2003, 11(11):773–782. 10.1016/S1063-4584(03)00165-1View ArticleGoogle Scholar
  27. Moustakas A, Souchelnytskyi S, Heldin CH: Smad regulation in TGF-β signal transduction. J Cell Sci 2001, 114(Pt 24):4359–4369.Google Scholar
  28. Grau AM, Datta PK, Zi J, Halder SK, Beauchamp RD: Role of Smad proteins in the regulation of NF-κB by TGF-β in colon cancer cells. Cell Signal 2006, 18(7):1041–1050. 10.1016/j.cellsig.2005.08.021View ArticleGoogle Scholar
  29. Monteleone G, Mann J, Monteleone I, Vavassori P, Bremner R, Fantini M, et al.: A failure of transforming growth factor-β1 negative regulation maintains sustained NF-kB activation in gut inflammation. J Biol Chem 2004, 279(6):3925–3932.View ArticleGoogle Scholar
  30. Asano Y, Ihn H, Yamane K, Kubo M, Tamaki K: Impaired Smad7-Smurf-mediated negative regulation of TGF-beta signaling in scleroderma fibroblasts. J Clin Invest 2004, 113(2):253–264.View ArticleGoogle Scholar

Copyright

© Xue et al.; licensee BioMed Central Ltd. 2013

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement