Skip to main content

Table 1 Primer sequences of the genes analysed by RT-PCR

From: Effects of dynamic radial tensile stress on fibrocartilage differentiation of bone marrow mesenchymal stem cells

Gene namesForward (5′–3′)Reverse (5′–3′)
Col ICCTGCGTACAGAACGGCCTACAGCACGTTGCCGTTGTC
Col IIAGCAGCAAGAGCAAGGACAAGTCTTGCAGTGGTAGGTGATGTT
α-SMAATAACCCTCCAGCCTTCAGCTCCCATTCCCACCATCACT
GAGsGTCCACCATTCGGCATAACCTGGGGTCACTTCAACCAAACT
GAPDHCAAGTTCCACGGCACAGTCAGGTTCACGCCCATCACAAA
  1. The genes of Col I, Col II, GAGs and α-SMA were analysed by RT-PCR. GAPDH was the internal reference gene used to normalize the relative expression level of other protein genes
  2. Col I, type I collagen; Col II, type II collagen; GAGs, glycosaminoglycans; α-SMA, α-smooth muscle actin