Skip to main content

Table 1 The promoter sequences used

From: Thymoquinone loading into hydroxyapatite/alginate scaffolds accelerated the osteogenic differentiation of the mesenchymal stem cells

Name Primer sequence (5′ → 3′) Melting point °C
Collagen 1 Forward: CGGCTCCTGCTCCTCTTAG 65
Reverse: GGGCTCGGGTTTCCACACG
Osteocalcin Forward: CCTCACACTCCTCGCCCTA 63
Reverse: TCTTCACTACCTCGCTGCC
Osteopontin Forward: CTCAGCCAAACGCCGACCAA 65
Reverse: TCCTCAGAACTTCCAGAATCAGCCT
β-Actin Forward: GCCTTTGCCGATCCGC 55
Reverse: GCCGTAGCCGTTGTCG
GAPDH Forward: GCAAGAGCACAAGAGGAAGA 57
Reverse: ACTGTGAGGAGGGGAGATTC