Skip to main content

Table 1 Sequence specific primers for quantitative real-time PCR (qPCR)

From: Differentiation of human adipose-derived stem cells into cardiomyocyte-like cells in fibrin scaffold by a histone deacetylase inhibitor

Name Forward sequence Reverse sequence
Connexin43 5′ATGACCAGTCTGCCTTTCGTTG3′ 5′CCATCAGTTTCGGCAACCTTG3′
GAPDH 5′TGCACCACCAACTGCTTAGC3′ 5′GGCATGGACTGTGGTCATGAG3′
cTnI 5′CAAGCAGGTGAAGAAGGAGG3′ 5′CTCAAACTTTTTCTTGCGGC3′
MLC2v 5′AAAGAGGCTCCAGGTCCAAT3′ 5′CCTCTCTGCTTGTGTGGTCA3′
GATA4 5′GTGTCACCTCGCTTCTCCTT3′ 5′GTGCCCTGTGCCATCTCT3′
βMHC 5′GATCACCAACAACCCCTACG3′ 5′ATGCAGAGCTGCTCAAAGC3′
NKX2.5 5′GGTGGAGCTGGAGAAGACAG3′ 5′AGATCTTGACCTGCGTGGAC3′
HAND2 5′TACCAGCTACATCGCCTACCT3′ 5′TCACTGCTTGAGCTCCAGGG3′
HAND1 5′AGCCACCAGCTACATCGCCTAC3′ GCGATCCGCCTTCTTGAGTTC3′