Skip to main content

Table 1 Chain reaction primers used for detection in this study

From: Porous deproteinized bovine bone scaffold with three-dimensional localized drug delivery system using chitosan microspheres

Primers sequence Target gene Product size (bp)
CGACAGCAAGCCCAAGAG ALP 110
GTGGAGACGCCCATACCA
ACATCCGCTCCACAAACG BMP-2 132
GGTGCCACGATCCAGTCA
CTTCTCAGAGCCTCAGTCC OCN 129
ACCGTAGATGCGTTTGTAG
CTGGCGGTGCAACAAGAC RUNX2 136
AACAGCGGAGGCATTTCG
ACTCGCTGCGCTCGGTCGTT ACTIN 125
CCTTTTGCTGGCCTTTTGCTCAC