Skip to main content

Table 1 List of gene-specific primers

From: Establishment of a pancreatic stem cell line from fibroblast-derived induced pluripotent stem cells

Gene Forward/Reverse primer (5′ → 3′)
Nanog cacaggctctttcttcagattg/tcttgcttgctcttcacattgg
Pdx1 cggacatctccccatacg/aaagggagctggacgcgg
Insulin-2 tccgctacaatcaaaaaccat/gctgggtagtggtgggtcta
Glucagon agaagggcagagcttgggcc/tgctgcctggccctccaagt
Amylase tggccttctggatcttgc/aaaggtctgcttccttggg
Somatostatin atgctgtcctgccgtctc/ttctctgtctggttgggctc
Gapdh accacagtccatgccatcac/tccaccaccctgttgctgta