Skip to main content

Table 2 Oligonucleotides primers used for RT-PCR, product size and cycles used

From: Short-term mechanical stretch fails to differentiate human adipose-derived stem cells into cardiovascular cell phenotypes

Target Forward Reverse PCR product (bp) Cycles
Calponin CAGATGGGCACCAACAAAG CATCTGCAGGCTGACATTGA 123 29
CD31 CCACTGCAGAGTACCAGCT CACCTTGGATGGCCTCTTTC 80 35
Cyclophilin ATGGTCAACCCCACCGTGT TCTGCTGTCTTTGGGACCTTGTC 101 24
GAPDH TGGTCTCCTCTGACTTCAACA AGCCAAATTCGTTGTCATACC 118 24
GATA4 CTGTCATCTCACTACGGGCA TAGCCTTGTGGGGAGAGCTT 122 34
KDR TCAGAAGAGCTGAAAACTT GAGCCTTCAGATGCCACAGA 80 34
MKL1 ACCGTGACCAATAAGAATGC CATCTGCTGGCTTGAGGAAC 240 29
MKL2 ATTTCCAACGCTCACAGTCA TTCACTGGCATTGTGGTGAT 146 29
Myocd TTCCTGTGGATTCTGCTGTG GGCTGTGAGGCTGAGTCATT 262 34
SM-MHC CCATCCAGTTTCCTCTCCAC GTCACTGAGTTGGCCCCTTCT 86 34