Skip to main content

Table 1 Oligonucleotides primers used for qRT-PCR

From: Short-term mechanical stretch fails to differentiate human adipose-derived stem cells into cardiovascular cell phenotypes

Target Forward (5′-3′) Reverse (5′-3′) PCR product (bp) cDNA (ng)
ACTA2 TTCAATGTCCCAGCCATGTA CATTGTGGGTGACACCATCT 109 15
Cyclophilin ATGGTCAACCCCACCGTGT TCTGCTGTCTTTGGGACCTTGTC 101 15
GAPDH TGGTCTCCTCTGACTTCAACA AGCCAAATTCGTTGTCATACC 118 25
MEF2C ATCTGCCCTCAGTCAGTTGG GGGTGGTGGTACGGTCTCTA 134 15
TAGLN AACAGCCTGTACCCTGATGG GCCCATCATTATTGGTCACT 212 25